Stem-loop sequence ame-mir-3788

AccessionMI0016197 (change log)
DescriptionApis mellifera miR-3788 stem-loop
Stem-loop
   cuc    g  ccuuaauca   -ua   -   uuac       cc   -gcaa    - auc     
5'    gacc cu         ggg   guu ccg    cuccugu  cuc     ucgu c   gucc 
      |||| ||         |||   ||| |||    |||||||  |||     |||| |   ||| c
3'    cugg ga         ccc   cga ggc    gagggcg  gag     agca g   cagu 
   --a    -  ---------   uag   a   ---c       -a   aaccc    a aac     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 7970196-7970308 [+]
intergenic
Database links

Mature sequence ame-miR-3788-5p

Accession MIMAT0018567
Sequence

25 - 

guuccguuaccuccugucccuc

 - 46

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).