Stem-loop sequence ame-mir-3787

AccessionMI0016196 (change log)
DescriptionApis mellifera miR-3787 stem-loop
Stem-loop
   c      c      uagggaa      -aa     --uc    -----   -    -   aaac      a  a 
5'  aucacg guuaua       ucgaua   acgag    gagc     uug ugug ugg    guucua ca c
    |||||| ||||||       ||||||   |||||    ||||     ||| |||| |||    |||||| ||  
3'  uagugc caaugu       agcuau   uguuu    uucg     aac gcgc acc    caaggu gu a
   u      c      uuuggac      aaa     uaac    uuaaa   u    g   -aaa      -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 5148158-5148295 [-]
intergenic
Database links

Mature sequence ame-miR-3787-5p

Accession MIMAT0018566
Sequence

32 - 

gagucgagcuuguguguggaa

 - 52

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).