Stem-loop sequence ame-mir-3784

AccessionMI0016193 (change log)
DescriptionApis mellifera miR-3784 stem-loop
Stem-loop
   -    uuuc  gc     c   a  -a    u   -uccg    uu 
5'  gcca    cg  gaaua aga ua  uucc cga     uucg  c
    ||||    ||  ||||| ||| ||  |||| |||     ||||   
3'  cggu    gc  uuuau uuu au  aagg gcu     gagc  a
   u    ccua  ua     c   a  aa    c   cucua    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 1692237-1692327 [+]
intergenic
Database links

Mature sequence ame-miR-3784-3p

Accession MIMAT0018563
Sequence

57 - 

ucgcggaaaauaauuucuauuu

 - 78

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).