Stem-loop sequence ame-mir-3783

AccessionMI0016191 (change log)
DescriptionApis mellifera miR-3783 stem-loop
Literature search

1 open access papers mention ame-mir-3783
(1 sentences)

Stem-loop
   a        aa  --ag  ag     g     c  c       g          --  aa 
5'  agaggacg  ga    ug  auggu ucauc ca caaacaa ugagagugug  uc  u
    ||||||||  ||    ||  ||||| ||||| || ||||||| ||||||||||  ||   
3'  ucuuuugc  uu    au  uacua agugg gu guuuguu acuuucauau  gg  a
   g        ag  aaua  cu     a     a  a       a          cu  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000064.5: 3872320-3872437 [+]
intergenic
Database links

Mature sequence ame-miR-3783-3p

Accession MIMAT0018561
Sequence

67 - 

uacuuucaauuguuugaugaggu

 - 89

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).