Stem-loop sequence ame-mir-3782

AccessionMI0016190 (change log)
DescriptionApis mellifera miR-3782 stem-loop
Stem-loop
   -   uuu      --------a     ---u    c  -  -      c u      a au   g   a    cau 
5'  gcu   gccaga         gacuu    cucc gc gc cugguc c gcagag c  cug cgg cacg   u
    |||   ||||||         |||||    |||| || || |||||| | |||||| |  ||| ||| ||||    
3'  cga   uggucu         cugaa    gagg cg cg gaccag g cgucuc g  gac gcc gugc   u
   c   --c      gacaaggag     cauu    a  g  u      c u      - cu   -   -    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000064.5: 1972004-1972138 [+]
intergenic
Database links

Mature sequence ame-miR-3782-5p

Accession MIMAT0018560
Sequence

35 - 

ccugcagagacaucuggcggacac

 - 58

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).