Stem-loop sequence ame-mir-3781

AccessionMI0016189 (change log)
DescriptionApis mellifera miR-3781 stem-loop
Stem-loop
   gaa     - gc     c    gugauugau        --a    g        ugaaua 
5'    gaauu g  ucuau gucg         gucaauua   acgc uauacaua      u
      ||||| |  ||||| ||||         ||||||||   |||| ||||||||       
3'    cuuaa c  aggug uagc         uaguuagu   ugug auaugugu      g
   --a     a uu     c    ---------        gaa    a        ugagcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 9177191-9177300 [+]
intergenic
Database links

Mature sequence ame-miR-3781-3p

Accession MIMAT0018559
Sequence

79 - 

uaagugauugaucgaucguggau

 - 101

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).