Stem-loop sequence ame-mir-965

AccessionMI0016187 (change log)
DescriptionApis mellifera miR-965 stem-loop
Gene family MIPF0000708; mir-965
Stem-loop
   -ug    u  u                   g  a     a aaa 
5'    gaca au ccaagggggaaagguuaua cg uuaug g   u
      |||| || ||||||||||||||||||| || ||||| |    
3'    uugu ua gguuucccuuuuucgauau gc aauac c   u
   uua    u  c                   -  g     - gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 11891746-11891832 [-]
intergenic
Database links

Mature sequence ame-miR-965-5p

Accession MIMAT0018557
Previous IDsame-miR-965
Sequence

16 - 

ggggaaagguuauagcgauuaug

 - 38

Get sequence
Evidence experimental; SOLID [1], Illumina [4]

Mature sequence ame-miR-965-3p

Accession MIMAT0022969
Sequence

52 - 

uaagcguauagcuuuuucccuu

 - 73

Get sequence
Evidence experimental; Illumina [2-4]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
4
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).