Stem-loop sequence ame-mir-3778

AccessionMI0016185 (change log)
DescriptionApis mellifera miR-3778 stem-loop
Stem-loop
   cua     -gg      uuauaaagauguu   -       --a ug          --a   g  g 
5'    ugaaa   guacga             gcg cuaauug   a  aauacuuguu   cuu ug a
      |||||   ||||||             ||| |||||||   |  ||||||||||   ||| || c
3'    auuuu   cguguu             cgu gguuaau   u  uuaugagcag   gaa gc c
   --a     aaa      ------------u   a       aua gu          aaa   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 4229101-4229217 [+]
intergenic
Database links

Mature sequence ame-miR-3778-3p

Accession MIMAT0018555
Sequence

86 - 

guauauaauuggaugcuuugugc

 - 108

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).