Stem-loop sequence ame-mir-3776

AccessionMI0016183 (change log)
DescriptionApis mellifera miR-3776 stem-loop
Stem-loop
   c   g     ------      -a  -a      g   aga    a     g 
5'  ggu cguga      aggggc  gg  ggaggg ggg   gaga gcguu u
    ||| |||||      ||||||  ||  |||||| |||   |||| ||||| a
3'  cca gcgcu      uccuug  cc  cuuuuu ccc   uuuu ugcga c
   a   a     uagcua      ca  gg      g   --g    a     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000067.5: 4517823-4517919 [-]
intergenic
Database links

Mature sequence ame-miR-3776-5p

Accession MIMAT0018553
Sequence

20 - 

aggagggggggagagagaagcg

 - 41

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).