Stem-loop sequence ame-mir-3775

AccessionMI0016182 (change log)
DescriptionApis mellifera miR-3775 stem-loop
Stem-loop
   aaucuuuuu   uuu   -g   g   a     uu     gau     uggu   aaaaau     ua  c 
5'          uac   uga  gcg aug ggagg  gaaua   gaucg    ugc      uugug  ca g
            |||   |||  ||| ||| |||||  |||||   |||||    |||      |||||  || u
3'          aug   auu  ugu uac ucucu  uuuau   uuagu    acg      aacau  gu u
   --------u   uuc   ag   a   a     -c     auu     ---u   ------     gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 6289657-6289782 [+]
intergenic
Database links

Mature sequence ame-miR-3775-5p

Accession MIMAT0018552
Sequence

17 - 

gaggcggaugaggagguugaaua

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).