Stem-loop sequence ame-mir-3722

AccessionMI0016180 (change log)
DescriptionApis mellifera miR-3722 stem-loop
Stem-loop
   au    -a  cg   aaa    gg    g  -c   -u  -      ag   u ac      g 
5'   ggaa  gu  gug   ccuu  gauc gc  aga  cc gauucg  gug g  gguuuc u
     ||||  ||  |||   ||||  |||| ||  |||  || ||||||  ||| |  ||||||  
3'   ucuu  ca  uac   ggga  uuag cg  ucu  gg cuaagc  cgu c  uuaaag u
   --    ag  au   cag    au    g  uu   cc  a      aa   u ga      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 7969149-7969270 [+]
intergenic
Database links

Mature sequence ame-miR-3722-5p

Accession MIMAT0018550
Sequence

36 - 

ccgauucgaggugugacgguu

 - 56

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).