Stem-loop sequence ame-mir-3769

AccessionMI0016173 (change log)
DescriptionApis mellifera miR-3769 stem-loop
Stem-loop
   a    -a      g  gg  c    u  gg       g  aaaaaaa  -a  -   g 
5'  ucuu  uagccu uu  uu ggcu au  aaaauug ga       gg  ga ucg a
    ||||  |||||| ||  || |||| ||  ||||||| ||       ||  || ||| a
3'  agag  guugga ag  aa ucga ug  uuuuaau cu       cc  cu agc a
   g    ca      -  ag  c    -  ga       g  ------c  gg  g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 8219604-8219711 [+]
intergenic
Database links

Mature sequence ame-miR-3769-3p

Accession MIMAT0018543
Sequence

82 - 

gguagcucaagagaagguugacg

 - 104

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).