Stem-loop sequence ame-mir-3767

AccessionMI0016171 (change log)
DescriptionApis mellifera miR-3767 stem-loop
Stem-loop
   -       ----------   -a             a  a      uguuuaa          a    ua 
5'  uguggaa          aua  acaauuucaauua ua uaguaa       aauguguaaa uauu  c
    |||||||          |||  ||||||||||||| || ||||||       |||||||||| ||||  a
3'  acaucuu          uau  uguuaaaguuaau au aucauu       uuacacauuu auaa  u
   u       acauuuauaa   ac             c  c      -----ua          -    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL631837.1: 714-838 [+]
intergenic
Database links

Mature sequence ame-miR-3767-3p

Accession MIMAT0018541
Sequence

70 - 

uacacauuauuuacuacuacu

 - 90

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).