Stem-loop sequence ame-mir-3766

AccessionMI0016170 (change log)
DescriptionApis mellifera miR-3766 stem-loop
Stem-loop
   gaa    ug    uggaauu    u    aacaa   u   ---        g    uuuu  a    a    c 
5'    uauu  auaa       uucg cgau     uuu uca   ucgaaauc aucu    cu gucg uauu g
      ||||  ||||       |||| ||||     ||| |||   |||||||| ||||    || |||| |||| a
3'    auag  uauu       aagu gcua     aag agu   aguuuugg ugga    ga cagu auga a
   --a    gu    uuagauu    -    -----   c   aaa        -    ---u  -    a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL630782.1: 2983-3117 [-]
intergenic
Database links

Mature sequence ame-miR-3766-3p

Accession MIMAT0018540
Sequence

87 - 

uaggugguuuugaaaaugacg

 - 107

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).