Stem-loop sequence ame-mir-3765

AccessionMI0016169 (change log)
DescriptionApis mellifera miR-3765 stem-loop
Stem-loop
   acaugacaacagaaaa     a           --gaa        aac g       -----   aa    a 
5'                 ugaag aaaggcaaguu     agaaucga   u auuugga     uug  auau a
                   ||||| |||||||||||     ||||||||   | |||||||     |||  ||||  
3'                 auuuc uuuccguucaa     uuuuaguu   g uaaauuu     aau  uaua a
   ---------------c     c           aaaaa        aaa g       cuaca   gc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 14571928-14572053 [+]
intergenic
Database links

Mature sequence ame-miR-3765-5p

Accession MIMAT0018539
Sequence

18 - 

gaagaaaaggcaaguugaaaga

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).