Stem-loop sequence ame-mir-3759

AccessionMI0016162 (change log)
DescriptionApis mellifera miR-3759 stem-loop
Literature search

1 open access papers mention ame-mir-3759
(1 sentences)

Stem-loop
   -    --a u    g   -    au    -   gg    --ag      g 
5'  ggcu   c cgga gcu aguu  gacg gag  ucug    agcggg g
    ||||   | |||| ||| ||||  |||| |||  ||||    ||||||  
3'  ucga   g gccu ugg ucag  cugc cuc  gggc    uugucc u
   c    auc c    g   g    --    a   -a    gugg      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL630411.1: 1156-1247 [+]
intergenic
Database links

Mature sequence ame-miR-3759-3p

Accession MIMAT0018532
Sequence

60 - 

gacucacgucgacuggguguccgc

 - 83

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).