Stem-loop sequence ame-mir-3719

AccessionMI0016161 (change log)
DescriptionApis mellifera miR-3719 stem-loop
Stem-loop
   a     --------auc  c   guc   u    c     ac     u         a       gaaa  g 
5'  augga           gg gcg   cac auac gggug  cgaaa gucgcgcaa cuguauu    cg c
    |||||           || |||   ||| |||| |||||  ||||| ||||||||| |||||||    || g
3'  ugccu           cc cgc   gug ugug cccac  gcuuu cagugcguu ggcauag    gc a
   a     gaaacccccac  a   aaa   -    a     ca     u         a       ---g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 7585524-7585658 [-]
intergenic
Database links

Mature sequence ame-miR-3719-3p

Accession MIMAT0018531
Sequence

74 - 

uacggauugcgugacuuuucga

 - 95

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).