Stem-loop sequence ame-mir-3758

AccessionMI0016160 (change log)
DescriptionApis mellifera miR-3758 stem-loop
Stem-loop
   c    cg u       ---   -       uc  ggac        
5'  cugg  g ccauuag   cag ucauaug  cu    caggugg 
    ||||  | |||||||   ||| |||||||  ||    |||||| a
3'  gacc  c ggugguc   guc aguauac  ga    guccacc 
   u    -- -       cug   c       -c  ---a        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
GL630569.1: 10784-10863 [-]
intergenic
Database links

Mature sequence ame-miR-3758-5p

Accession MIMAT0018530
Sequence

18 - 

agucauauguccuggaccaggu

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).