Stem-loop sequence ame-mir-3718b

AccessionMI0016156 (change log)
DescriptionApis mellifera miR-3718b stem-loop
Gene family MIPF0001225; mir-3718
Stem-loop
   u   a   agua      cu  c       a     c    ---ga   aau      ac 
5'  ucg uuc    ccgauu  ca uaucggg cagga aggg     cag   gguuau  c
    ||| |||    ||||||  || ||||||| ||||| ||||     |||   ||||||   
3'  agc aag    ggcuaa  gu auagccu guccu uccc     guc   ccggua  g
   c   -   ----      au  a       a     a    auccc   ---      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000059.5: 6820246-6820356 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3718b
ame-mir-3718aCM000059.5: 6820223-6820362 [-]
ame-mir-3718bCM000059.5: 6820246-6820356 [+]
ame-mir-3718cCM000059.5: 6820449-6820538 [-]
Database links

Mature sequence ame-miR-3718b-5p

Accession MIMAT0018526
Sequence

26 - 

ucgggacaggacaggggacaga

 - 47

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).