Stem-loop sequence ame-mir-3755

AccessionMI0016155 (change log)
DescriptionApis mellifera miR-3755 stem-loop
Stem-loop
   ca     ucaaaaaug                u      auc  u 
5'   uaugu         uguauauauaauuaua cguguu   gu c
     |||||         |||||||||||||||| ||||||   || g
3'   auacg         acauauauauuaauau gcguaa   ca c
   -g     ----uuaga                u      -ca  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 10213532-10213618 [+]
intergenic
Database links

Mature sequence ame-miR-3755-5p

Accession MIMAT0018525
Sequence

13 - 

aauguguauauauaauuauaucgug

 - 37

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).