Stem-loop sequence ame-mir-3753

AccessionMI0016153 (change log)
DescriptionApis mellifera miR-3753 stem-loop
Stem-loop
   -         cga  gg   cg   --c     cg -     -ga    ----  -   c 
5'  acaacagau   uc  cag  ugu   cguuu  g gacuc   ccgu    cg gca a
    |||||||||   ||  |||  |||   |||||  | |||||   ||||    || |||  
3'  uguuguuua   ag  guu  aca   gcaag  c uugag   ggcg    gc cgu a
   a         cgg  aa   au   uuc     aa a     aag    uaga  u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 10887324-10887435 [+]
intergenic
Database links

Mature sequence ame-miR-3753-5p

Accession MIMAT0018523
Sequence

22 - 

uguccguuucgggacucgaccg

 - 43

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).