Stem-loop sequence ame-mir-3752

AccessionMI0016152 (change log)
DescriptionApis mellifera miR-3752 stem-loop
Stem-loop
   -  g    acgaau  c      -gag     a        --aauu     caacgc 
5'  gu cgca      ag gaagcu    cuaua uuuagaaa      aucga      g
    || ||||      || ||||||    ||||| ||||||||      |||||      u
3'  ca gcgu      uc cuuuga    ggugu aaaucuuu      uagcu      u
   c  a    ------  -      aaua     c        accuuu     uccccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 8352494-8352601 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3752
ame-mir-3751CM000062.5: 8355801-8355937 [+]
ame-mir-3752CM000062.5: 8352494-8352601 [-]
Database links

Mature sequence ame-miR-3752-3p

Accession MIMAT0018522
Sequence

85 - 

guggauaaaguuuccuugcgaa

 - 106

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).