Stem-loop sequence ame-mir-3748

AccessionMI0016147 (change log)
DescriptionApis mellifera miR-3748 stem-loop
Stem-loop
   guc  uua    gugcgg     --a   -      acaga       u u  -a    ag 
5'    gg   cuuu      ggaga   uaa uuuuac     uggaacg g cg  uagc  u
      ||   ||||      |||||   ||| ||||||     ||||||| | ||  ||||  c
3'    cc   gaaa      ccuuu   guu aaaaug     acuuugc c gc  auug  c
   --c  ucc    auuaaa     aac   c      ---aa       - u  gg    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 1888686-1888800 [-]
intergenic
Database links

Mature sequence ame-miR-3748-3p

Accession MIMAT0018517
Sequence

69 - 

cguccguuucaaaguaaaacuu

 - 90

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).