Stem-loop sequence ame-mir-3747b

AccessionMI0016146 (change log)
DescriptionApis mellifera miR-3747b stem-loop
Gene family MIPF0001223; mir-3747
Stem-loop
   uac     gc   ------------             c        c        a 
5'    ccagu  cag            uucugcgagauuu uuuucagu gugaauaa a
      |||||  |||            ||||||||||||| |||||||| |||||||| a
3'    gguua  guc            aaggcgcucuaaa aaaggucg cacuuauu u
   --u     --   uagcacauaaaa             a        u        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 13108273-13108373 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3747b
ame-mir-3747aCM000061.5: 13107663-13107729 [+]
ame-mir-3747bCM000061.5: 13108273-13108373 [+]
Database links

Mature sequence ame-miR-3747b-5p

Accession MIMAT0018516
Sequence

17 - 

ugcgagauuucuuuucagucgug

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).