Stem-loop sequence ame-mir-3747a

AccessionMI0016145 (change log)
DescriptionApis mellifera miR-3747a stem-loop
Gene family MIPF0001223; mir-3747
Stem-loop
   ggc  g                          a 
5'    cu cgaggcuuuuuuucagcgaugaauaa a
      || |||||||||||||||||||||||||| a
3'    ga guucugaaaaaagguugcuacuuguu u
   --a  g                          a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 13107663-13107729 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3747a
ame-mir-3747aCM000061.5: 13107663-13107729 [+]
ame-mir-3747bCM000061.5: 13108273-13108373 [+]
Database links

Mature sequence ame-miR-3747a-5p

Accession MIMAT0018515
Sequence

7 - 

cgaggcuuuuuuucagcgauga

 - 28

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).