Stem-loop sequence ame-mir-3746

AccessionMI0016144 (change log)
DescriptionApis mellifera miR-3746 stem-loop
Stem-loop
   c      ---    uc      -    a  uuaca    aaua          -         u    a    
5'  uuucgg   aucu  uucucu gaca gu     guac    uuuucuuugu uuuuuuuuc uuuu uga 
    ||||||   ||||  |||||| |||| ||     ||||    |||||||||| ||||||||| |||| || g
3'  aaagcu   uaga  aagaga cugu cg     uaug    aggagaggcg aaagaagag gaaa acg 
   a      ccg    -c      g    g  -----    --ga          c         c    c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 9890594-9890725 [+]
intergenic
Database links

Mature sequence ame-miR-3746-3p

Accession MIMAT0018514
Sequence

87 - 

cgcggagaggaagguaugcgu

 - 107

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).