Stem-loop sequence ame-mir-307

AccessionMI0016139 (change log)
DescriptionApis mellifera miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
   ga   gcauc    aaau       a   gga         ccu    -     ----   --u     u 
5'   gga     ucga    ggcgguc cgu   cucacucaa   gggu gugau    gcu   gccug g
     |||     ||||    ||||||| |||   |||||||||   |||| |||||    |||   ||||| u
3'   ccu     agcu    uugucag gca   gagugaguu   ucca cacua    cga   cggac a
   -a   auacc    -auu       c   agc         -uu    a     cugg   ucc     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 7127563-7127695 [+]
intergenic
Database links

Mature sequence ame-miR-307-3p

Accession MIMAT0018509
Sequence

84 - 

ucacaaccuuuuugagugagcga

 - 106

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).