Stem-loop sequence ame-mir-11

AccessionMI0016136 (change log)
DescriptionApis mellifera miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

2 open access papers mention ame-mir-11
(6 sentences)

Stem-loop
   --a  gag  u      ac     -          g      cu    -ug    c 
5'    ug   ga agccgu  ccuga uggagcucug cuguga  ugug   uuaa u
      ||   || ||||||  ||||| |||||||||| ||||||  ||||   |||| g
3'    ac   cu uuggca  ggauu aucuugagac gacacu  acac   aauu a
   aca  aaa  -      au     g          g      --    uaa    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 5463633-5463740 [-]
intergenic
Database links

Mature sequence ame-miR-11-3p

Accession MIMAT0018506
Sequence

66 - 

caucacaggcagaguucuaguu

 - 87

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).