Stem-loop sequence hsa-mir-3679

Accession

MI0016080 (change log)

Symbol

HGNC:MIR3679

Description

Homo sapiens miR-3679 stem-loop

Literature search

5 open access papers mention hsa-mir-3679
(31 sentences)

Stem-loop

               --a   ca          guuu 
5' cguggugaggau   ugg  gggaagggga    c
   ||||||||||||   |||  ||||||||||    c
3' guacuacuucua   acc  cccuucccuu    c
               aug   -c          aucu 

Deep sequencing

1269 reads, 0 reads per million, 110 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 134127125-134127192 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000331995 ; NCKAP5-004; intron 1

  OTTHUMT00000331996 ; NCKAP5-005; intron 2

  OTTHUMT00000331663 ; NCKAP5-001; intron 3

  OTTHUMT00000331993 ; NCKAP5-002; intron 3

  ENST00000427594 ; NCKAP5-004; intron 1

  ENST00000317721 ; NCKAP5-201; intron 1

  ENST00000405974 ; NCKAP5-202; intron 1

  ENST00000358991 ; NCKAP5-005; intron 2

  ENST00000409261 ; NCKAP5-001; intron 3

  ENST00000409213 ; NCKAP5-002; intron 3

Database links

• EntrezGene:MIR3679
• HGNC:MIR3679
• RNAcentral:URS000075AC34_9606
• miRBase Tracker:MI0016080

Mature sequence hsa-miR-3679-5p

• Accession: MIMAT0018104
• Sequence: 6 - ugaggauauggcagggaagggga - 28
• Deep sequencing: 1236 reads, 109 experiments
• Evidence: experimental; Illumina [1-3]
• Database links:
  • RNAcentral:URS00000D0BB4_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3679-5p
  • TargetScanVert:hsa-miR-3679-5p
  • miRDB:hsa-miR-3679-5p

Mature sequence hsa-miR-3679-3p

• Accession: MIMAT0018105
• Sequence: 44 - cuuccccccaguaaucuucauc - 65
• Deep sequencing: 24 reads, 19 experiments
• Evidence: experimental; Illumina [1,3]
• Predicted targets:
  • TargetMiner:hsa-miR-3679-3p
  • TargetScanVert:hsa-miR-3679-3p
  • miRDB:hsa-miR-3679-3p

References

1. PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).