![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3670-1 |
||||||||
Accession | MI0016071 (change log) | |||||||
Previous IDs | hsa-mir-3670 | |||||||
Symbol | HGNC:MIR3670-1 | |||||||
Description | Homo sapiens miR-3670-1 stem-loop | |||||||
Gene family | MIPF0001340; mir-3670 | |||||||
Stem-loop |
-cu u cuuuug - c 5' ucuaga gg auagcug gagc cuca c |||||| || ||||||| |||| |||| u 3' agaucu cc ugucgac cucg gagu g cuu - -----a a c |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
Mature sequence hsa-miR-3670 |
|
Accession | MIMAT0018093 |
Sequence |
40 - agagcucacagcuguccuucucua - 63 |
Deep sequencing | 44 reads, 10 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20459673
"Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
BMC Genomics. 11:288(2010).
|