Stem-loop sequence hsa-mir-3660

AccessionMI0016061 (change log)
Symbol HGNC:MIR3660
DescriptionHomo sapiens miR-3660 stem-loop
Gene family MIPF0001397; mir-3660
Literature search

1 open access papers mention hsa-mir-3660
(1 sentences)

Stem-loop 
   gaa   aga   g      a                   u   -a   g 
5'    aga   acu gacaaa uuaaaaugcucuucuguca ugu  aua u
      |||   ||| |||||| ||||||||||||||||||| |||  ||| u
3'    ucu   uga cuguuu aguuuuacgagaggacagu acg  uau c
   ucg   gug   a      c                   c   gg   a
Get sequence
Deep sequencing
272 reads, 29.8 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 90016621-90016720 [-]
antisense
OTTHUMT00000369995 ; GPR98-003; intron 12
OTTHUMT00000369993 ; GPR98-001; intron 44
ENST00000509621 ; GPR98-003; intron 12
ENST00000405460 ; GPR98-001; intron 44
Database links

Mature sequence hsa-miR-3660

Accession MIMAT0018081
Sequence

60 -  

acugacaggagagcauuuuga

 - 80

Get sequence
Deep sequencing245 reads, 40 experiments
Evidence experimental; Northern [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).