Stem-loop sequence vvi-MIR3631d

Accession

MI0016030 (change log)

Description

Vitis vinifera miR3631d stem-loop

Gene family

MIPF0001100; MIR3631

Literature search

2 open access papers mention vvi-MIR3631d
(4 sentences)

Stem-loop

            c     a    caa               g            uaucaauaa                  uau    a      a          a g                  ugau 
5' uaaaaguaa cuauu auau   ccaacauaauuaaaa ugaacuuguuau         guuuaguuuaguuauauu   ugau uuaaua guuacuuuua c gaauaggaaaaacuaagg    g
   ||||||||| ||||| ||||   ||||||||||||||| ||||||||||||         ||||||||||||||||||   |||| |||||| |||||||||| | ||||||||||||||||||     
3' auuuucauu gauaa uaua   gguuguauuaauuuu acuugaacaaua         caagucaaauuaauauaa   acua aguugu caaugaaaau g cuuaucuuuuuugauuuu    u
            a     c    aua               -            -------ua                  ccu    c      a          a a                  uguu 

Deep sequencing

261 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Database links

• miRBase Tracker:MI0016030

Mature sequence vvi-miR3631d

• Accession: MIMAT0018034
• Sequence: 165 - cauguugacaucauccaauaua - 186
• Deep sequencing: 115 reads, 2 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:20230504 "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J Plant J. 62:960-976(2010).