![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3619 |
|||||
Accession | MI0016009 (change log) | ||||
Symbol | HGNC:MIR3619 | ||||
Description | Homo sapiens miR-3619 stem-loop | ||||
Literature search |
5 open access papers mention hsa-mir-3619 | ||||
Stem-loop |
-a -a u c g ag g 5' acggc ucuuugc c cagcaggcagg uggu c ccc u ||||| ||||||| | ||||||||||| |||| | ||| g 3' ugucg aggaaug g gucguccgucc acca g ggg g gc gg u u g -- u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3619-5p |
|
Accession | MIMAT0017999 |
Previous IDs | hsa-miR-3619 |
Sequence |
16 - ucagcaggcaggcuggugcagc - 37 |
Deep sequencing | 151 reads, 56 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
Mature sequence hsa-miR-3619-3p |
|
Accession | MIMAT0019219 |
Sequence |
47 - gggaccauccugccugcugugg - 68 |
Deep sequencing | 58 reads, 30 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|