Stem-loop sequence hsa-mir-1302-10

Accession

MI0015979 (change log)

Symbol

HGNC:MIR1302-10

Description

Homo sapiens miR-1302-10 stem-loop

Gene family

MIPF0000456; mir-1302

Literature search

6 open access papers mention hsa-mir-1302-10
(84 sentences)

Stem-loop

   ggaugccca   --ag                     g      --uucg        a              
5'          gcu    uuugaauuuuagauaaacaac aauaau      uagcauaa uaugucccaagcu 
            |||    ||||||||||||||||||||| ||||||      |||||||| |||||||||||| u
3'          cga    agacuuagagucuauuuguug uuauua      aucguauu auacaggguuuga 
   ---auuuua   auua                     g      caaaaa        c              

Deep sequencing

92 reads, 2.22 reads per million, 45 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr15: 101960459-101960596 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000416834 ; PCSK6-009; intron 1

  OTTHUMT00000416830 ; PCSK6-008; intron 5

  OTTHUMT00000416835 ; PCSK6-010; intron 5

  OTTHUMT00000416811 ; PCSK6-001; intron 6

  OTTHUMT00000416814 ; PCSK6-005; intron 6

  OTTHUMT00000416812 ; PCSK6-003; intron 6

  OTTHUMT00000416815 ; PCSK6-004; intron 6

  OTTHUMT00000416899 ; PCSK6-019; intron 6

  OTTHUMT00000416813 ; PCSK6-002; intron 6

  OTTHUMT00000416896 ; PCSK6-016; intron 6

  ENST00000557794 ; PCSK6-009; intron 1

  ENST00000331826 ; PCSK6-201; intron 4

  ENST00000398185 ; PCSK6-008; intron 5

  ENST00000559417 ; PCSK6-010; intron 5

  ENST00000561177 ; PCSK6-001; intron 6

  ENST00000560921 ; PCSK6-005; intron 6

  ENST00000561109 ; PCSK6-003; intron 6

  ENST00000559678 ; PCSK6-004; intron 6

  ENST00000560271 ; PCSK6-019; intron 6

  ENST00000558716 ; PCSK6-002; intron 6

  ENST00000561444 ; PCSK6-016; intron 6

  ENST00000348070 ; PCSK6-203; intron 7

  ENST00000358417 ; PCSK6-204; intron 7

  ENST00000344273 ; PCSK6-202; intron 7

  ENST00000398181 ; PCSK6-205; intron 7

Database links

• EntrezGene:MIR1302-10
• HGNC:MIR1302-10
• RNAcentral:URS000075CC93_9606
• miRBase Tracker:MI0015979

Mature sequence hsa-miR-1302

• Accession: MIMAT0005890
• Sequence: 73 - uugggacauacuuaugcuaaa - 93
• Deep sequencing: 653 reads, 33 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000442977_9606
• Predicted targets:
  • TargetMiner:hsa-miR-1302
  • TargetScanVert:hsa-miR-1302
  • miRDB:hsa-miR-1302
  • microrna.org:hsa-miR-1302

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).