Dead miRNA entry

miRNA accession:
MI0015976
miRNA ID:
hsa-mir-1270-2
Forward to:
MI0006407
Comment:
The two previously annotated mir-1270 sequences map to a single locus in the GRCh38 genome assembly. The entries are merged in miRBase 21.

Previous miRNA entry

Stem-loop sequence hsa-mir-1270-2

AccessionMI0015976 (change log)
Symbol HGNC:MIR1270-2~withdrawn
DescriptionHomo sapiens miR-1270-2 stem-loop
Stem-loop
   --  c         cu       u         g     ggu 
5'   ca agaguuaua  ggagaua ggaagagcu uguug   a
     || |||||||||  ||||||| ||||||||| |||||    
3'   gu ucucggugu  cuucuau ucuuuucgg acaau   u
   ac  u         au       u         -     gaa 
Get sequence
Deep sequencing
2997 reads, 0 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1270

Accession MIMAT0005924
Sequence

13 - 

cuggagauauggaagagcugugu

 - 35

Get sequence
Deep sequencing5962 reads, 103 experiments
Evidence experimental; Illumina [1]