Dead miRNA entry

miRNA accession:
MI0015970
miRNA ID:
dre-let-7e-2
Forward to:
MI0001871
Comment:
Two annotated let-7e loci collapse to a single locus in the Zv9 assembly.

Previous miRNA entry

Stem-loop sequence dre-let-7e-2

AccessionMI0015970 (change log)
DescriptionDanio rerio let-7e-2 stem-loop
Stem-loop
         --       cu   gu         a        ---------     c 
5' gcuguu  cuugggg  gag  aguagauug auaguugu         ggagc c
   ||||||  |||||||  |||  ||||||||| ||||||||         ||||| u
3' cgacag  gaauccu  uuc  ucaucuaac uaucaaua         ucucg g
         cg       --   ug         a        gagucucuc     c 
Get sequence
Deep sequencing
58098 reads, 3.7e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dre-let-7e

Accession MIMAT0001763
Sequence

15 - 

cugagguaguagauugaauagu

 - 36

Get sequence
Deep sequencing115766 reads, 11 experiments
Evidence experimental;