Stem-loop sequence rno-mir-3546

AccessionMI0015400 (change log)
DescriptionRattus norvegicus miR-3546 stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
         gagacgaua   -   c    caaca       u     uc      g  a 
5' ggcuga         gcu ccu ugac     agcuuuu gcucg  uuauac ug g
   ||||||         ||| ||| ||||     ||||||| |||||  |||||| || a
3' ccgacu         uga gga acug     ucgaaaa cgggc  aauaug ac g
         gggaacgaa   a   a    cccac       c     cc      g  u 
Get sequence
Deep sequencing
1908 reads, 0 reads per million, 131 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 33613435-33613550 [+]
antisense
ENSRNOT00000023302 ; Myh6-201; intron 28
Clustered miRNAs
< 10kb from rno-mir-3546
rno-mir-3546chr15: 33613435-33613550 [+]
rno-mir-208achr15: 33613451-33613533 [-]
Database links

Mature sequence rno-miR-3546

Accession MIMAT0017801
Sequence

66 - 

auaacccgggccaaaagcucac

 - 87

Get sequence
Deep sequencing1647 reads, 124 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).