Stem-loop sequence gso-MIR2109

AccessionMI0015369 (change log)
DescriptionGlycine soja miR2109 stem-loop
Gene family MIPF0001000; MIR2109
Literature search

2 open access papers mention gso-MIR2109
(5 sentences)

Stem-loop
         u    uc    c        u          ---a     acu 
5' agccag gaaa  ggug gagugucu cgccucugag    gagau   a
   |||||| ||||  |||| |||||||| ||||||||||    |||||    
3' ucgguc uuuu  ccac cucauaga gcggaggcuc    cucua   u
         u    cu    a        u          cgaa     gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR2109

Accession MIMAT0016363
Sequence

16 - 

ugcgagugucuucgccucuga

 - 36

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).