Stem-loop sequence gso-MIR2218

AccessionMI0015367 (change log)
DescriptionGlycine soja miR2218 stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention gso-MIR2218
(2 sentences)

Stem-loop
   u        g       a    a   -           --u       u uc  uga 
5'  gaggaagu augggag uggg ggg ucgguaaagga   aacagcg c  ua   u
    |||||||| ||||||| |||| ||| |||||||||||   ||||||| |  ||    
3'  uucuuuua uauccuu accc ccu agccguuuucu   uuguugu g  gu   u
   u        g       -    a   u           uau       - uu  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR2218

Accession MIMAT0016361
Sequence

79 - 

uugccgauuccacccauuccua

 - 100

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).