Stem-loop sequence gso-MIR3522b

AccessionMI0015366 (change log)
DescriptionGlycine soja miR3522b stem-loop
Gene family MIPF0000936; MIR3522
Literature search

1 open access papers mention gso-MIR3522b
(1 sentences)

Stem-loop
        au  u       c  a            -cca  ugau   g 
5' acagg  cg ccugaga ca augagcagcuga    ca    gca c
   |||||  || ||||||| || ||||||||||||    ||    |||  
3' uguuc  gc ggacucu gu uacucgucgacu    gu    ugu u
        cc  u       u  c            uauc  ---u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR3522b

Accession MIMAT0016360
Sequence

13 - 

ugagaccaaaugagcagcugac

 - 34

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).