Stem-loop sequence gso-MIR1507b

AccessionMI0015364 (change log)
DescriptionGlycine soja miR1507b stem-loop
Gene family MIPF0000699; MIR1507
Literature search

3 open access papers mention gso-MIR1507b
(4 sentences)

Stem-loop
        a    -                  a     au  uauu uc      
5' guuug caga gauguauggagugagaga gggaa  ga    u  cgauc 
   ||||| |||| |||||||||||||||||| |||||  ||    |  |||| c
3' caagc gucu cuacauaccuuacucucu cccuu  cu    a  gcuac 
        a    g                  -     cu  ---c uu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR1507b

Accession MIMAT0016358
Sequence

72 - 

ucucauuccauacaucgucuga

 - 93

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).