Stem-loop sequence gso-MIR1507a

AccessionMI0015363 (change log)
DescriptionGlycine soja miR1507a stem-loop
Gene family MIPF0000699; MIR1507
Literature search

3 open access papers mention gso-MIR1507a
(4 sentences)

Stem-loop
             -                  a     -      uuuuc      
5' guuugucaga gguguauggagugagaga gggaa agggua     cgauu 
   |||||||||| |||||||||||||||||| ||||| ||||||     |||| c
3' caagcagucu cuacauaccuuacucucu cccuu ucucau     gcugu 
             g                  -     c      ----u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR1507a

Accession MIMAT0016357
Sequence

72 - 

ucucauuccauacaucgucuga

 - 93

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).