Stem-loop sequence gso-MIR1510a

AccessionMI0015362 (change log)
DescriptionGlycine soja miR1510a stem-loop
Gene family MIPF0000703; MIR1510
Literature search

2 open access papers mention gso-MIR1510a
(10 sentences)

Stem-loop
       uu       cu  a                ug    -     -   g 
5' ggau  uauggaa  gg gggauagguaaaacaa  acug cugua uaa u
   ||||  |||||||  || ||||||||||||||||  |||| ||||| |||  
3' ccua  guaccuu  cc ccuuauccauuuuguu  ugau gauau guu a
       -u       ac  a                gu    u     u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR1510a

Accession MIMAT0016356
Sequence

67 - 

uguuguuuuaccuauuccacc

 - 87

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).