Stem-loop sequence gso-MIR1510b

AccessionMI0015361 (change log)
DescriptionGlycine soja miR1510b stem-loop
Gene family MIPF0000703; MIR1510
Literature search

2 open access papers mention gso-MIR1510b
(6 sentences)

Stem-loop
       uuu      g   a                 u   -u      -  g 
5' ggau   auggaa ugg gggauagguaaaacaac acu  cuguaa aa u
   ||||   |||||| ||| ||||||||||||||||| |||  |||||| ||  
3' ccua   uaccuu acc ccuuauccauuuuguug uga  gauauu uu a
       -uc      a   a                 u   uu      g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR1510b

Accession MIMAT0016355
Sequence

67 - 

uguuguuuuaccuauuccacc

 - 87

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).