Stem-loop sequence gso-MIR482a

AccessionMI0015359 (change log)
DescriptionGlycine soja miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

1 open access papers mention gso-MIR482a
(1 sentences)

Stem-loop
             ug           -auu           uc    ag 
5' ggggaaggca  gguaugggggg    gggaaggaaua  caua  c
   ||||||||||  |||||||||||    |||||||||||  ||||  a
3' uccuuuuugu  ccauacccucc    cccuucuuuau  guau  a
             ca           acau           -c    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR482a

Accession MIMAT0016353
Sequence

60 - 

ucuucccuacaccucccauac

 - 80

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).