Stem-loop sequence gso-MIR1508a

AccessionMI0015358 (change log)
DescriptionGlycine soja miR1508a stem-loop
Gene family MIPF0000719; MIR1508
Literature search

1 open access papers mention gso-MIR1508a
(1 sentences)

Stem-loop
   u    uu    uc           -   a      a   -   uuaca      
5'  ugaa  gcua  caacugcuauu ccc uuucua acc uug     cgagc 
    ||||  ||||  ||||||||||| ||| |||||| ||| |||     |||| a
3'  acuu  uggu  guugacgauaa ggg aaagau ugg aac     guucu 
   a    cg    ga           a   -      c   u   ---ua      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gso-miR1508a

Accession MIMAT0016352
Sequence

68 - 

uagaaagggaaauagcaguug

 - 88

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).