Stem-loop sequence ppy-mir-942

AccessionMI0015175 (change log)
DescriptionPongo pygmaeus miR-942 stem-loop
Gene family MIPF0000511; mir-942
Stem-loop
               c                   g   uacuca 
5' auuaggagagua cuucucuguuuuggccaug gug      c
   |||||||||||| ||||||||||||||||||| |||       
3' uaauccuuucau gaagagacaaagccgguac cac      a
               u                   a   uccccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 111057258-111057343 [-]
intergenic
Database links

Mature sequence ppy-miR-942

Accession MIMAT0016140
Sequence

13 - 

ccuucucuguuuuggccauggg

 - 34

Get sequence
Evidence not experimental

References

1