Stem-loop sequence ppy-mir-449b

AccessionMI0014948 (change log)
DescriptionPongo pygmaeus miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---------uga  u   u     a     u   uu   a c        uugg 
5'             cc gaa caggu ggcag gua  guu g uggcugcu    u
               || ||| ||||| ||||| |||  ||| | ||||||||    c
3'             gg cuu guuca ccguc cau  caa c accgacga    a
   ucuucuuaaaua  u   c     -     c   --   - -        cuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 56431862-56431958 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-449b
ppy-mir-449bchr5: 56431862-56431958 [-]
ppy-mir-449achr5: 56431748-56431838 [-]
Database links

Mature sequence ppy-miR-449b

Accession MIMAT0015892
Sequence

16 - 

aggcaguguauuguuagcuggc

 - 37

Get sequence
Evidence not experimental

References

1