Stem-loop sequence ppy-mir-449a

AccessionMI0014947 (change log)
DescriptionPongo pygmaeus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -c      ug     c       -    u          ugaa   g 
5'   ugugug  augag uggcagu guau guuagcuggu    uau u
     ||||||  ||||| ||||||| |||| ||||||||||    |||  
3'   auauac  uauuc gucguca cgug caaucggcua    gua g
   ac      gu     u       a    -          --cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 56431748-56431838 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-449a
ppy-mir-449bchr5: 56431862-56431958 [-]
ppy-mir-449achr5: 56431748-56431838 [-]
Database links

Mature sequence ppy-miR-449a

Accession MIMAT0015891
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Evidence not experimental

References

1