Stem-loop sequence bta-mir-2284x

AccessionMI0014499 (change log)
DescriptionBos taurus miR-2284x stem-loop
Gene family MIPF0000747; mir-2284
Literature search

17 open access papers mention bta-mir-2284x
(42 sentences)

Stem-loop 
   --------ggau   g            ug       cg  c        c 
5'             uua uauuggguuggc  aaaaguu  uu ggguuuuu c
               ||| ||||||||||||  |||||||  || ||||||||  
3'             aau augacccaaccg  uuuucaa  aa cucaagaa a
   ccacguagucac   a            gu       au  a        u
Get sequence
Deep sequencing
170936 reads, 962 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 3605102-3605197 [-]
antisense
ENSBTAT00000023716 ; TIAM1-202; intron 5
Database links

Mature sequence bta-miR-2284x

Accession MIMAT0017395
Sequence

21 -  

ugaaaaguucguucggguuuu

 - 41

Get sequence
Deep sequencing170883 reads, 77 experiments
Evidence experimental; qPCR [2], Illumina [3]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
PMID:20423511 "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL BMC Mol Biol. 11:29(2010).
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).